logo

 

Reactiv artrita anti vimentin


 


Anti- vimentin antisense phosphorodiamidate Morpholino oligomers targeting the splicing junction between the first exon and second intron of human vimentin pre- mRNA ( sequence, TTGCATGGGCGCAGCCTTACTTCTC) were purchased from Gene Tools ( Philomath, OR). The cells were labeled with Vimentin ( V9) Mouse Monoclonal Antibody ( Product # MAat 2 µg/ mL in 0. More> > Detect Vimentin using this Anti- Vimentin Antibody validated for use in IC. 1% BSA and incubated for 3 hours at room temperature and then labeled with Goat anti- Mouse IgG ( H+ L) Superclonal™ Secondary Antibody, Alexa Fluor® 488 conjugate ( Product # A28175) at a dilution of 1: 20 minutes at room. Recently, utilizing proteomic analysis on serum samples from hepatocellular carcinoma ( HCC) patients, it was shown that vimentin is heavily secreted by small HCCs. Key Applications:. Vimentin Antibody ( C- 20) is a goat polyclonal recommended for detecting Vimentin of mouse, rat, human and Xenopus origin by WB, IP, IF, IHC( P) and ELISA Vimentin Antibodies Millipore’ s Anti- Vimentin antibodies demonstrate specificity against Vimentin and show broad species reactivity. Anti- Vimentin Antibody detects level of Vimentin & has been published & validated for use in IC, IH, IH( P) & WB. See below for Vimentin antibodies, based on the expertise of Upstate & Chemicon. Less< < Anti- Vimentin Antibody MSDS ( material safety data sheet) or SDS, CoA and CoQ, dossiers, brochures and other available documents. Reactiv artrita anti vimentin. Further, the authors suggested the presence of anti- vimentin autoantibodies in the serum of Sézary patients, which can serve as an excellent marker for diagnosis or prognosis.